Protein tyrosine phosphatase non-receptor kind 5 (PTPN5), additionally referred to as striatal-enriched protein tyrosine phosphatase (STEP), is extremely expressed in neurons of the basal ganglia, hippocampus, cortex, and associated constructions, additionally within the pituitary.
Gonadotropins are the important thing regulator of the replica in mammals. On this research, PTPN5 is detected to specific in murine pituitary in a developmental method. Furthermore, the expression of PTPN5 within the pituitary is closely diminished after ovary elimination.
Follicle-stimulating hormone (FSH) secretion in gonadotropes is regulated by PTPN5 through binding GnRH to GnRH-R. Two parallel signaling pathways, Gs-protein kinase A (PKA)-PTPN5 and Gq-phospholipases C (PLC)-p38 MAPK-PTPN5, cooperatively regulate GnRH-induced FSH secretion.
We additionally present that inflow of Ca2+ prompts the Ca2+ -dependent phosphatase calcineurin, resulting in the phosphorylation and activation of PTPN5. The intracellular launch of Ca2+ is diminished through TC2153.
In conclusion, blocking or knocking out of PTPN5 reduces the discharge of FSH in entire pituitary. Mechanically, PTPN5 regulates gonadotropes’ perform by means of regulating intracellular calcium homeostasis.

Pargyline and р-Chlorophenylalanine Lower Expression of Ptpn5 Encoding Striatal-Enriched Protein Tyrosine Phosphatase (STEP) within the Mouse Striatum.

Striatal-enriched protein tyrosine phosphatase (STEP), which was initially recognized within the striatum, is encoded by the Ptpn5 gene and is expressed in neurons of varied constructions of the mind.
STEP is concerned in regulating neuroplasticity, and its expression abnormalities are related to human neurodegenerative issues. The STEP inhibitor 8-trifluoromethyl-1,2,3,4,5-benzopentathiepin-6-amine hydrochloride (TC-2153) has been proven to have an effect on the serotoninergic system of the mind.
Nonetheless, the affect of the serotoninergic system on the STEP regulation has not been studied but. The purpose of the research was to research how pharmacologically induced adjustments within the mind serotonin (5-HT) degree have an effect on Ptpn5 expression and STEP exercise in grownup male C57BL/6J mice.
To modulate the 5-HT degree within the mind, the 5-HT synthesis inhibitor p-chlorophenylalanine or 5-HT degradation inhibitor pargyline was administered intraperitoneally for 3 successive days.
Adjustments in 5-HT focus within the mind have been assayed utilizing high-performance liquid chromatography. The STEP exercise was decided spectrophotometrically within the supernatant by the speed of p-nitrophenyl phosphate dephosphorylation within the absence and presence of the selective STEP inhibitor TC-2153.
The Ptpn5 mRNA degree was decided utilizing quantitative RT-PCR. The Ptpn5 expression degree within the striatum was thrice greater than within the cortex and hippocampus. Each will increase and reduces in mind 5-HT have been for the primary time related to a lower in Ptpn5 mRNA within the striatum.
STEP exercise within the striatum and cortex was considerably greater than within the hippocampus. Nonetheless, p-chlorophenylalanine and pargyline didn’t have an effect on the STEP exercise within the mind constructions examined.
Thus, a brand new technique was proposed to review the STEP exercise within the mind and p-chlorophenylalanine and pargyline have been proven to lower Ptpn5 expression within the striatum in mice.

Allosteric Activation of Striatal-Enriched Protein Tyrosine Phosphatase (STEP, PTPN5) by a Fragment-like Molecule.

Protein tyrosine phosphatase non-receptor kind 5 (PTPN5, STEP) is a mind particular phosphatase that regulates synaptic perform and plasticity by modulation of N-methyl-d-aspartate receptor (NMDAR) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) trafficking.
Dysregulation of STEP has been linked to neurodegenerative and neuropsychiatric ailments, highlighting this enzyme as a pretty therapeutic goal for drug discovery. Selective concentrating on of STEP with small molecules has been hampered by excessive conservation of the lively web site amongst protein tyrosine phosphatases.
We report the invention of the primary small molecule allosteric activator for STEP that binds to the phosphatase area. Allosteric binding is confirmed by each X-ray and 15N NMR experiments, and specificity has been demonstrated by an enzymatic take a look at cascade.
Molecular dynamics simulations point out stimulation of enzymatic exercise by a long-range allosteric mechanism. To permit the scientific group to utilize this device, we provide to supply the compound in the middle of an open innovation initiative.
Crystal constructions and inhibitor identification for PTPN5, PTPRR and PTPN7: a household of human MAPK-specific protein tyrosine phosphatases.
Protein tyrosine phosphatases PTPN5, PTPRR and PTPN7 comprise a household of phosphatases that particularly inactivate MAPKs (mitogen-activated protein kinases). We’ve got decided high-resolution constructions of all the human members of the family, screened them towards a library of 24000 compounds and recognized two courses of inhibitors, cyclopenta[c]quinolinecarboxylic acids and a couple of,5-dimethylpyrrolyl benzoic acids.
 PTPN5 promotes follicle-stimulating hormone secretion through regulating intracellular calcium homeostasis
Comparative structural evaluation revealed important variations inside this conserved household that might be explored for the design of selective inhibitors. PTPN5 crystallized, in two distinct crystal varieties, with a sulphate ion in shut proximity to the lively web site and the WPD (Trp-Professional-Asp) loop in a novel conformation, not seen in different PTPs, ending in a 3(10)-helix.
Within the PTPN7 construction, the WPD loop was within the closed conformation and a part of the KIM (kinase-interaction motif) was seen, which varieties an N-terminal aliphatic helix with the phosphorylation web site Thr66 in an accessible place.
The WPD loop of PTPRR was open; nevertheless, in distinction with the construction of its mouse homologue, PTPSL, a salt bridge between the conserved lysine and aspartate residues, which has been postulated to confer a extra inflexible loop construction, thereby modulating exercise in PTPSL, doesn’t type in PTPRR.
One of many recognized inhibitor scaffolds, cyclopenta[c]quinoline, was docked efficiently into PTPRR, suggesting a number of prospects for hit enlargement. The decided constructions along with the established SAR (structure-activity relationship) suggest new avenues for the event of selective inhibitors that will have therapeutic potential for treating neurodegenerative ailments within the case of PTPRR or acute myeloblastic leukaemia concentrating on PTPN7.

PTPN5 promotes follicle-stimulating hormone secretion by means of regulating intracellular calcium homeostasis

Protein tyrosine phosphatase non-receptor kind 5 (PTPN5), additionally referred to as striatal-enriched protein tyrosine phosphatase (STEP), is extremely expressed in neurons of the basal ganglia, hippocampus, cortex, and associated constructions, additionally within the pituitary.
Gonadotropins are the important thing regulator of the replica in mammals. On this research, PTPN5 is detected to specific in murine pituitary in a developmental method. Furthermore, the expression of PTPN5 within the pituitary is closely diminished after ovary elimination.
Follicle-stimulating hormone (FSH) secretion in gonadotropes is regulated by PTPN5 through binding GnRH to GnRH-R. Two parallel signaling pathways, Gs-protein kinase A (PKA)-PTPN5 and Gq-phospholipases C (PLC)-p38 MAPK-PTPN5, cooperatively regulate GnRH-induced FSH secretion.

PTPN5 antibody

70R-6729 50 ug
EUR 467
Description: Rabbit polyclonal PTPN5 antibody

PTPN5 Antibody

1-CSB-PA019042GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PTPN5. Recognizes PTPN5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PTPN5 Antibody

1-CSB-PA019042LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPN5. Recognizes PTPN5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PTPN5 siRNA

20-abx904371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPN5 siRNA

20-abx930383
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPN5 siRNA

20-abx930384
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPN5 Blocking Peptide

33R-9722 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PTPN5 antibody, catalog no. 70R-6729

STEP / PTPN5 Antibody

abx033947-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

STEP / PTPN5 Antibody

abx033947-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PTPN5 Conjugated Antibody

C40066 100ul
EUR 397

PTPN5 cloning plasmid

CSB-CL019042HU-10ug 10ug
EUR 586
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1698
  • Sequence: atgaattatgagggagccaggagtgagagagagaaccacgctgctgatgactccgagggaggggccctggacatgtgctgcagtgagaggctaccgggtctcccccagccgatagtgatggaggcactggacgaggctgaagggctccaggactcacagagagagatgccgccac
  • Show more
Description: A cloning plasmid for the PTPN5 gene.

PTPN5 Polyclonal Antibody

A56098 100 µg
EUR 570.55
Description: reagents widely cited

PTPN5 Rabbit pAb

A16585-100ul 100 ul
EUR 308

PTPN5 Rabbit pAb

A16585-200ul 200 ul
EUR 459

PTPN5 Rabbit pAb

A16585-20ul 20 ul
EUR 183

PTPN5 Rabbit pAb

A16585-50ul 50 ul
EUR 223

anti- PTPN5 antibody

FNab06939 100µg
EUR 548.75
  • Immunogen: protein tyrosine phosphatase, non-receptor type 5(striatum-enriched)
  • Uniprot ID: P54829
  • Gene ID: 84867
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PTPN5

Anti-PTPN5 antibody

PAab06939 100 ug
EUR 386

Anti-PTPN5 antibody

STJ119024 100 µl
EUR 277

anti-STEP / PTPN5

YF-PA21501 50 ul
EUR 363
Description: Mouse polyclonal to STEP / PTPN5

anti-STEP / PTPN5

YF-PA21502 100 ug
EUR 403
Description: Rabbit polyclonal to STEP / PTPN5

anti-STEP / PTPN5

YF-PA26749 50 ul
EUR 334
Description: Mouse polyclonal to STEP / PTPN5

PTPN5 ELISA KIT|Human

EF002175 96 Tests
EUR 689

Mouse Ptpn5 ELISA KIT

ELI-43088m 96 Tests
EUR 865

Mouse PTPN5 shRNA Plasmid

20-abx972296
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTPN5 shRNA Plasmid

20-abx985641
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTPN5 Antibody, HRP conjugated

1-CSB-PA019042LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPN5. Recognizes PTPN5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTPN5 Antibody, FITC conjugated

1-CSB-PA019042LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPN5. Recognizes PTPN5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTPN5 Antibody, Biotin conjugated

1-CSB-PA019042LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPN5. Recognizes PTPN5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PTPN5 shRNA Plasmid

20-abx963649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPN5 ELISA KIT

ELI-35863h 96 Tests
EUR 824

PTPN5 Recombinant Protein (Human)

RP025204 100 ug Ask for price

PTPN5 Recombinant Protein (Mouse)

RP165680 100 ug Ask for price

PTPN5 Recombinant Protein (Mouse)

RP165683 100 ug Ask for price

PTPN5 Recombinant Protein (Rat)

RP222947 100 ug Ask for price

Anti-STEP / PTPN5 (2H5)

YF-MA19579 100 ug
EUR 363
Description: Mouse monoclonal to STEP / PTPN5

PTPN5 Polyclonal Antibody, HRP Conjugated

A56099 100 µg
EUR 570.55
Description: Ask the seller for details

PTPN5 Polyclonal Antibody, FITC Conjugated

A56100 100 µg
EUR 570.55
Description: The best epigenetics products

PTPN5 Polyclonal Antibody, Biotin Conjugated

A56101 100 µg
EUR 570.55
Description: kits suitable for this type of research

Ptpn5 ORF Vector (Rat) (pORF)

ORF074317 1.0 ug DNA
EUR 506

PTPN5 ORF Vector (Human) (pORF)

ORF008402 1.0 ug DNA
EUR 95

Ptpn5 ORF Vector (Mouse) (pORF)

ORF055228 1.0 ug DNA
EUR 506

Ptpn5 ORF Vector (Mouse) (pORF)

ORF055229 1.0 ug DNA
EUR 506

Polyclonal PTPN5 / STEP Antibody (N-Terminus)

APR13023G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTPN5 / STEP (N-Terminus). This antibody is tested and proven to work in the following applications:
We additionally present that inflow of Ca2+ prompts the Ca2+ -dependent phosphatase calcineurin, resulting in the phosphorylation and activation of PTPN5. The intracellular launch of Ca2+ is diminished through TC2153. In conclusion, blocking or knocking out of PTPN5 reduces the discharge of FSH in entire pituitary. Mechanically, PTPN5 regulates gonadotropes’ perform by means of regulating intracellular calcium homeostasis.

LEAVE A REPLY

Please enter your comment!
Please enter your name here